Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250281

Morpholino Name: sdcbp MO2
Synonyms: Xsyntenin-a
mRNA Target: sdcbp

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGGGATATAGAGACATTTTCACAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' CTGTAAAAATGTCTCTGTATCCCTC 3' |||| ||||||||||| |||||||| 3' GACACTTTTACAGAGATATAGGGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold58038:3335513..3335537 25/25 Antisense off-target Xelaev16063592m
Scaffold230826:3991850..3991874 23/25 Antisense off-target Xelaev16030009m
Scaffold210343:118767..118791 21/25 unknown
Scaffold27557:388568..388592 21/25 unknown
Scaffold44061:1045725..1045749 21/25 unknown
Scaffold84188:472677..472701 21/25 Sense off-target Xelaev16075784m
tropicalis 7.1 scaffold_6:33393373..33393397 23/25 Antisense target sdcbp
scaffold_5:46400058..46400082 21/25 Antisense off-target sim1
Publications
First: The postsynaptic density 95/disc-large/zona occludens protein syntenin directly interacts with frizzled 7 and supports noncanonical Wnt signaling., Mol Biol Cell 2008                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556