Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250301

Morpholino Name: shh MO2
Synonyms: Shh splice MO
mRNA Target: shh

Morpholino Type: uncategorized morpholino
Sequence:
5' CACGTATGGCCGTACCTGAGTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATGACTCAGGTACGGCCATACGTG 3' ||||||||||||||||||||||||| 3' GTACTGAGTCCATGCCGGTATGCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_6:129427016..129427040 25/25 Antisense target shh
Publications
First: A revised model of Xenopus dorsal midline development: differential and separable requirements for Notch and Shh signaling., Dev Biol 2011                                
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556