Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250307

Morpholino Name: shroom3 MO1
Synonyms: shroom3 MO
mRNA Target: shroom3

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCATACATACCCTCTCATCAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23 21/23
genomic

MO
5' CCTGATGAGAGGGTATGTATGCA 3' ||||||||||||||||||||||| 3' GGACTACTCTCCCATACATACGT 5' 5' GCTGAAGAGAGGGTATGTATGCA 3' |||| ||||||||||||||||| 3' GGACTACTCTCCCATACATACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold58878:5506222..5506244 21/23 Antisense target shroom3.L
Scaffold250059:57583..57605 20/23 Antisense off-target Xelaev16033311m
Scaffold11316:3244750..3244772 19/23 unknown
Scaffold12423:911104..911126 19/23 unknown
Scaffold20505:73543..73565 19/23 unknown
Scaffold22415:5136269..5136291 19/23 Antisense off-target Xelaev16029312m
Scaffold3036:463700..463722 19/23 unknown
tropicalis 7.1 scaffold_8:19397805..19397827 23/23 Antisense target shroom3
Publications
First: Shroom induces apical constriction and is required for hingepoint formation during neural tube closure., Curr Biol 2003                            
Most recent: Mechanical roles of apical constriction, cell elongation, and cell migration during neural tube formation in Xenopus., Biomech Model Mechanobiol 2016                
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556