Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250310

Morpholino Name: sia2 MO1
Synonyms: Twin, Twn-MO
mRNA Target: sia2

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCAGAGTCACAAGTCATGTCTGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CACAGACATGACTTGTGACTCTGAG 3' |||||||||||||||||||||||| 3' GTGTCTGTACTGAACACTGAGACTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold193742:186194..186218 24/25 Antisense off-target Xelaev16024566m
Scaffold31449:922749..922773 22/25 unknown
Scaffold203187:512893..512917 21/25 unknown
Scaffold233955:131380..131404 21/25 Sense off-target Xelaev16030726m
Scaffold34527:6293116..6293140 21/25 Antisense off-target Xelaev16045387m
Scaffold402746:3517092..3517116 21/25 unknown
Scaffold51452:5809281..5809305 21/25 unknown
Scaffold71264:625703..625727 21/25 Sense off-target foxj1.L
tropicalis 7.1 scaffold_40:14301..14325 24/25 Antisense target sia2
scaffold_40:25241..25265 21/25 unknown
scaffold_40:36395..36419 21/25 Antisense off-target sia1
Publications
First: Expression of Siamois and Twin in the blastula Chordin/Noggin signaling center is required for brain formation in Xenopus laevis embryos., Mech Dev 2008                
Most recent: A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer., Dev Biol 2011                              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556