Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250311

Morpholino Name: sia2 MO2
Synonyms: Twn MO
mRNA Target: sia2

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCAAGTTCAGAGTCACAAGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGACTTGTGACTCTGAGCTTGAGC 3' ||||||||||||||||| ||||||| 3' TACTGAACACTGAGACTTGAACTCG 5' 5' ATGACTTGTGACTCTGAACTTGAGC 3' ||||||||||||||||||||||||| 3' TACTGAACACTGAGACTTGAACTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold233955:245197..245221 25/25 Antisense target sia2.S
Scaffold193742:186187..186211 24/25 Antisense off-target Xelaev16024566m
Scaffold372288:433920..433944 22/25 unknown
Scaffold102262:2286924..2286948 21/25 unknown
tropicalis 7.1 scaffold_40:14308..14332 24/25 Antisense target sia2
scaffold_1:169858877..169858901 21/25 unknown
scaffold_7:5373343..5373367 21/25 Antisense off-target fgf16
Publications
First: Siamois and Twin are redundant and essential in formation of the Spemann organizer., Dev Biol 2011                      
Most recent: Early neural ectodermal genes are activated by Siamois and Twin during blastula stages., Genesis 2015            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556