Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250312

Morpholino Name: sin3a MO1
Synonyms: Sin3A morpholino
mRNA Target: sin3a

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCGTCCAATCGCCGCTTCATCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AGGATGAAGCGGCGACTGGATGAGC 3' ||||||||||||||| |||| |||| 3' TCCTACTTCGCCGCTAACCTGCTCG 5' 5' AGGATGAAGCGGCGATTGGACGAGC 3' ||||||||||||||||||||||||| 3' TCCTACTTCGCCGCTAACCTGCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7197:1348661..1348685 25/25 Antisense target sin3a.S
Scaffold12518:1906759..1906783 24/25 Antisense off-target Xelaev16006985m
tropicalis 7.1 scaffold_7:53259607..53259631 23/25 Antisense target sin3a
Publications
First: A mutant form of MeCP2 protein associated with human Rett syndrome cannot be displaced from methylated DNA by notch in Xenopus embryos., Mol Cell 2003                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556