Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250313

Morpholino Name: six1 MO1
Synonyms: Six1MO1, six1
mRNA Target: six1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGAAGGCAGCATAGACATGGCTCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CTGAGCCATGTCTATGCTGCCTTCC 3' ||||||||||||||||||||||||| 3' GACTCGGTACAGATACGACGGAAGG 5' 5' CTGAGCCATGTCTATGCTGCCTTCC 3' ||||||||||||||||||||||||| 3' GACTCGGTACAGATACGACGGAAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold133644:382336..382360 25/25 Antisense off-target Xelaev16009742m
Scaffold45985:1604407..1604431 25/25 Antisense target six1.L
Scaffold116982:99..123 22/25 unknown
Scaffold176905:100..124 22/25 unknown
Scaffold278800:19..43 22/25 unknown
Scaffold61797:19..43 22/25 unknown
tropicalis 7.1 scaffold_8:81395484..81395508 25/25 Antisense target six1
Publications
First: Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor., Development 2004                      
Most recent: Six1 and Irx1 have reciprocal interactions during cranial placode and otic vesicle formation., Dev Biol 2019                        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556