Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250314

Morpholino Name: six1 MO2
Synonyms: Six1MO2, six1
mRNA Target: six1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCACACGCAAACACATACACGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' CCCGTGTATGTGTTTGCGTGTGCG 3' |||||||||||||||||||||||| 3' GGGCACATACACAAACGCACACGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45985:1604456..1604479 24/24 Antisense target six1.L
Scaffold317991:281567..281590 22/24 unknown
Scaffold96659:3861618..3861641 22/24 unknown
Scaffold11199:3916113..3916136 21/24 unknown
Scaffold46492:721145..721168 21/24 Antisense off-target Xelaev16056165m
Scaffold12423:773718..773741 20/24 unknown
Scaffold139674:521094..521117 20/24 unknown
Scaffold145462:608536..608559 20/24 unknown
Scaffold155039:2361994..2362017 20/24 Antisense off-target Xelaev16016109m
Scaffold167347:3152343..3152366 20/24 Sense off-target atg4a.L
Scaffold167800:1499094..1499117 20/24 unknown
Scaffold16807:8207065..8207088 20/24 unknown
Scaffold183929:2899757..2899780 20/24 Antisense off-target Xelaev16022824m
Scaffold190664:1344909..1344932 20/24 Sense off-target Xelaev16024087m
Scaffold23301:5397820..5397843 20/24 Sense off-target Xelaev16030662m
Scaffold245044:2782255..2782278 20/24 unknown
Scaffold34503:3674151..3674174 20/24 unknown
Scaffold389081:127218..127241 20/24 unknown
Scaffold46631:863920..863943 20/24 unknown
Scaffold47091:274510..274533 20/24 unknown
Scaffold51452:5171786..5171809 20/24 unknown
Scaffold69443:9142183..9142206 20/24 unknown
Scaffold73623:1749036..1749059 20/24 Sense off-target sall3.L
Scaffold79772:4383199..4383222 20/24 unknown
Scaffold83106:260717..260740 20/24 unknown
tropicalis 7.1 scaffold_8:63501509..63501532 22/24 unknown
scaffold_3:78241686..78241709 20/24 unknown
scaffold_4:139252525..139252548 20/24 Antisense off-target dcp1a
scaffold_9:48294416..48294439 20/24 Antisense off-target hdac4
Publications
First: Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor., Development 2004                      
Most recent: Six1 and Irx1 have reciprocal interactions during cranial placode and otic vesicle formation., Dev Biol 2019                        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556