Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250314

Morpholino Name: six1 MO2
Synonyms: Six1MO2, six1
Target mRNA: six1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCACACGCAAACACATACACGGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' CCCGTGTATGTGTTTGCGTGTGCG 3' |||||||||||||||||||||||| 3' GGGCACATACACAAACGCACACGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:79054033..79054056 24/24 Antisense target six1.L
chr8S:97218905..97218928 21/24 Antisense off-target tpm3.S
chr2S:97083094..97083117 20/24 Sense off-target LOC108709734 [provisional:shox]
chr4L:16449321..16449344 20/24 Antisense off-target Xelaev18022024m
chr4L:16449321..16449344 20/24 Sense off-target LOC108713833 [provisional:brsk2]
chr4L:74859872..74859895 20/24 Antisense off-target angptl3.L
chr4L:74859872..74859895 20/24 Sense off-target dock7.L
chr4S:92859941..92859964 20/24 Sense off-target tnrc6b.S
chr6L:96642048..96642071 20/24 Sense off-target sall3.L
chr6S:76065488..76065511 20/24 Sense off-target sall3.S
chr7L:8526784..8526807 20/24 Sense off-target LOC108696071 [provisional:prkg1]
chr7L:8526907..8526930 20/24 Sense off-target LOC108696071 [provisional:prkg1]
chr7S:78869027..78869050 20/24 Sense off-target LOC108697787 [provisional:igsf1]
chr8L:30517035..30517058 20/24 Sense off-target atg4a.L
chr8L:91199640..91199663 20/24 Sense off-target ap4s1.L
chr8L:66866938..66866961 22/24 unknown
chr8S:18856073..18856096 22/24 unknown
chr6S:58347800..58347823 21/24 unknown
chr1S:170363553..170363576 20/24 unknown
chr1S:62762312..62762335 20/24 unknown
chr1S:62762868..62762891 20/24 unknown
chr4L:103118758..103118781 20/24 unknown
chr4L:1822954..1822977 20/24 unknown
chr4L:61110206..61110229 20/24 unknown
chr4S:74246071..74246094 20/24 unknown
chr5S:109054643..109054666 20/24 unknown
chr6S:105615958..105615981 20/24 unknown
chr6S:26381178..26381201 20/24 unknown
chr7L:69670670..69670693 20/24 unknown
tropicalis 10.0 Chr3:49473477..49473500 20/24 Sense off-target stab2
Chr4:150729266..150729289 20/24 Antisense off-target dcp1a
Chr9:60809502..60809525 20/24 Antisense off-target hdac4
Chr8:89478736..89478759 22/24 unknown
Chr1:215068296..215068319 20/24 unknown
Publications
First: Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor., Development 2004                      
Most recent: Six1 and Irx1 have reciprocal interactions during cranial placode and otic vesicle formation., Dev Biol 2019                        
View All Papers