Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250329

Morpholino Name: smad2 MO1
Synonyms: Smad2a, Smad2a-MO
Target mRNA: smad2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTGAAAGGCAAGATGGACGACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATGTCGTCCATCTTGCCTTTCACC 3' ||||||||||||||||||||||||| 3' GTACAGCAGGTAGAACGGAAAGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:210660763..210660787 25/25 Antisense target smad2.L
tropicalis 10.0 Chr1:16358476..16358500 22/25 Antisense off-target LOC100145764
Chr1:16502346..16502370 22/25 Antisense off-target LOC116406512
Chr2:61332987..61333011 21/25 unknown
Publications
First: A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer., Dev Biol 2011                              
Most recent: Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a., Elife 2017                                                              
View All Papers