Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250330

Morpholino Name: smad2 MO2
Synonyms: Smad2b-MO, smad2b
mRNA Target: smad2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTGAATGGCAAAATCGAGCACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CATGTCCTCGATTTTGCCATTCACC 3' ||||| ||||||||||||||||||| 3' GTACACGAGCTAAAACGGTAAGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold40963:1480364..1480388 24/25 Antisense target smad2.S
Scaffold179914:826909..826933 21/25 unknown
tropicalis 7.1 scaffold_1:6382168..6382192 22/25 Antisense off-target smad3
scaffold_3:78046715..78046739 21/25 unknown
Publications
First: A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer., Dev Biol 2011                              
Most recent: Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a., Elife 2017                                        
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556