Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250330

Morpholino Name: smad2 MO2
Synonyms: Smad2b-MO, smad2b
Target mRNA: smad2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTGAATGGCAAAATCGAGCACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25
genomic

MO
5' CATGTCCTCCATTTTGCCATTTACC 3' ||||| ||| ||||||||||| ||| 3' GTACACGAGCTAAAACGGTAAGTGG 5' 5' CATGTCCTCGATTTTGCCATTCACC 3' ||||| ||||||||||||||||||| 3' GTACACGAGCTAAAACGGTAAGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:174261550..174261574 24/25 Antisense target smad2.S
chr4S:64269450..64269474 21/25 unknown
tropicalis 10.0 Chr1:206106105..206106129 22/25 Antisense target smad2
Chr3:49274068..49274092 21/25 unknown
Publications
First: A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer., Dev Biol 2011                              
Most recent: Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a., Elife 2017                                                              
View All Papers