Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250332

Morpholino Name: smad4.2 MO1
Synonyms: Smad10 MO, XSmad4beta1-MO
mRNA Target: smad4.2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCCATCTTTTGCCCTTGTTGTTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GTAACAACAAGGGCAAAAGATGGCG 3' ||||||||||||||||||||||||| 3' CATTGTTGTTCCCGTTTTCTACCGC 5' 5' GTAACATCAAGGGGAAAAGATGGCG 3' |||||| |||||| ||||||||||| 3' CATTGTTGTTCCCGTTTTCTACCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:118047922..118047946 25/25 Antisense target smad4.2.L
chr8S:97554090..97554114 23/25 Antisense target smad4.2.S
chr8S:97554090..97554114 23/25 Antisense target smad4.2.S
chr5L:89231482..89231506 21/25 Antisense off-target snap91.L
tropicalis 10.0 Chr4:143867525..143867549 21/25 Sense off-target magi1
Chr7:1505051..1505075 21/25 Antisense off-target sorcs1
Chr9:66873551..66873575 21/25 Sense off-target map3k20
Chr2:24559682..24559706 21/25 unknown
Publications
First: Smad10 is required for formation of the frog nervous system., Dev Cell 2002              
Most recent: FAM/USP9x, a deubiquitinating enzyme essential for TGFbeta signaling, controls Smad4 monoubiquitination., Cell 2009    
View All Papers