Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250333

Morpholino Name: smad4.2 MO2
Synonyms: XSmad4beta2-MO
mRNA Target: smad4.2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGGTCAGAGACATGGCCGGGATCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GAGATCCCGGCCATGTCTCTGACCC 3' ||||||||||||||||||||||||| 3' CTCTAGGGCCGGTACAGAGACTGGG 5' 5' GAGATCCCGGCCATGTCTCTGACCC 3' ||||||||||||||||||||||||| 3' CTCTAGGGCCGGTACAGAGACTGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:118052947..118052971 25/25 Antisense target smad4.2.L
chr8S:97557453..97557477 25/25 Antisense target smad4.2.S
chr8S:97557453..97557477 25/25 Antisense target smad4.2.S
Scaffold76848:232..256 25/25 unknown
Publications
First: FAM/USP9x, a deubiquitinating enzyme essential for TGFbeta signaling, controls Smad4 monoubiquitination., Cell 2009    
Most recent:
View All Papers