Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250334

Morpholino Name: smad6 MO1
Synonyms: smad6 MO
mRNA Target: smad6

Morpholino Type: uncategorized morpholino
Sequence:
5' CCGTGCGTCTGGACCTGAACATGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 24/25
genomic

MO
5' CGCATGTTCAGGTCCAGACGCACCG 3' |||||||||||||||||||||| | 3' CCGTACAAGTCCAGGTCTGCGTGCC 5' 5' CGCATGTTCAGGTCCAGACGCACGG 3' |||||||||||||||||||||||| 3' CCGTACAAGTCCAGGTCTGCGTGCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold58049:4764539..4764563 24/25 Antisense target smad6.L
Scaffold36401:3804044..3804068 23/25 Antisense off-target Xelaev16047539m
tropicalis 7.1 scaffold_3:32378148..32378172 23/25 Antisense target smad6
Publications
First: Negative feedback in the bone morphogenetic protein 4 (BMP4) synexpression group governs its dynamic signaling range and canalizes development., Proc Natl Acad Sci U S A 2011        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556