Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250335

Morpholino Name: smad7 MO1
Synonyms: smad7 MO
mRNA Target: smad7

Morpholino Type: uncategorized morpholino
Sequence:
5' ACGAGAGCAAGGCTTCCCGGCTAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TTTAGCCGGGAAGCCTTGCTCTCGT 3' ||||||||||||||||||||||||| 3' AAATCGGCCCTTCGGAACGAGAGCA 5' 5' TTTAGCCGGGAAGCCTTGCTCTCGT 3' ||||||||||||||||||||||||| 3' AAATCGGCCCTTCGGAACGAGAGCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold143831:941995..942019 25/25 Antisense target smad7.L
Scaffold396958:52..76 25/25 unknown
Scaffold40963:954465..954489 25/25 Antisense off-target Xelaev16051964m
tropicalis 7.1 scaffold_1:5368277..5368301 25/25 Antisense target smad7
Publications
First: Negative feedback in the bone morphogenetic protein 4 (BMP4) synexpression group governs its dynamic signaling range and canalizes development., Proc Natl Acad Sci U S A 2011        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556