Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250336

Morpholino Name: smad7 MO2
Synonyms: smad7 MO
mRNA Target: smad7

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGCGGGACGAGAGCAAGGCTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24 24/24
genomic

MO
5' GGAAGCCTTGCTCTCGTCCCGCAT 3' |||||||||||||||||||||||| 3' CCTTCGGAACGAGAGCAGGGCGTA 5' 5' GGAAGCCTTGCTCTCGTCCCGCAT 3' |||||||||||||||||||||||| 3' CCTTCGGAACGAGAGCAGGGCGTA 5' 5' GGAAGCCTTGCTCTCGTCCCGCAT 3' |||||||||||||||||||||||| 3' CCTTCGGAACGAGAGCAGGGCGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:210129748..210129771 24/24 Antisense target smad7.L
chr1S:173735644..173735667 24/24 Antisense target smad7.S
tropicalis 10.0 Chr1:205595810..205595833 24/24 Antisense target smad7
Chr1:205595810..205595833 24/24 Antisense off-target Xetrov107008403m.g
Publications
First: Regulation of activin/nodal signaling by Rap2-directed receptor trafficking., Dev Cell 2008  
Most recent:
View All Papers