Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250341

Morpholino Name: smarcal1 MO1
Synonyms: smarcal1
mRNA Target: smarcal1

Morpholino Type: uncategorized morpholino
Sequence:
5' TCAGACACACTGACATCTCTCCTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' TCAGGAGAGATGTCAGTGTGTCTGA 3' ||||||||||||||||||||||||| 3' AGTCCTCTCTACAGTCACACAGACT 5' 5' TCCGGAGAGATGTCCGTCTGTCTGA 3' || ||||||||||| || ||||||| 3' AGTCCTCTCTACAGTCACACAGACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold21603:278404..278428 22/25 Antisense target smarcal1.L
Scaffold134022:412737..412761 21/25 unknown
Scaffold203041:4347097..4347121 21/25 Antisense off-target Xelaev16025974m
Scaffold36134:1315611..1315635 21/25 unknown
Scaffold93786:1048105..1048129 21/25 Antisense off-target Xelaev16079161m
tropicalis 7.1 scaffold_9:1724018..1724042 25/25 Antisense target smarcal1
scaffold_3:76067438..76067462 21/25 Antisense off-target tspan5
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556