Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250344

Morpholino Name: smn1 MO1
Synonyms: MoSMNd
mRNA Target: smn1

Morpholino Type: splice blocking morpholino
Sequence:
5' CTCTCCACTAGAAAACAGTACATTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAATGTACTGTTTTCTAGTGGAGAG 3' ||||||||||||||||||||||||| 3' CTTACATGACAAAAGATCACCTCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:157164937..157164961 21/25 Sense off-target b3glct.L
chr2L:74242189..74242213 21/25 Sense off-target shroom2.L
chr4L:22329971..22329995 21/25 unknown
chr4L:95633775..95633799 21/25 Sense off-target cdc7.L
Scaffold46:201093..201117 21/25 unknown
tropicalis 10.0 Chr1:182579734..182579758 25/25 Antisense target smn1
Chr3:98210669..98210693 21/25 Antisense off-target lrrc49
Publications
First: Reduced levels of survival motor neuron protein leads to aberrant motoneuron growth in a Xenopus model of muscular atrophy., Neurogenetics 2010    
Most recent:
View All Papers