Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250345

Morpholino Name: smn1 MO2
Synonyms: MoSMNatg
mRNA Target: smn1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GAGCCTGCCATAGACACGCTACTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25 22/25
genomic

MO
5' GAAGTAGCGTGTCTATGGCAGGCTC 3' ||||||||||||||||||||||||| 3' CTTCATCGCACAGATACCGTCCGAG 5' 5' AAAGTAGCGTGTCTATGGCAGGTTT 3' ||||||||||||||||||||| | 3' CTTCATCGCACAGATACCGTCCGAG 5' 5' AAAGTAGCGTGTCTATGGCAGGTTT 3' ||||||||||||||||||||| | 3' CTTCATCGCACAGATACCGTCCGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:185576627..185576651 22/25 Antisense target smn1.L
chr1S:154683291..154683315 22/25 Antisense target smn1.S
Scaffold24:1667617..1667641 21/25 Sense off-target cacna2d3.L
chr2L:22820100..22820124 21/25 unknown
tropicalis 10.0 Chr1:182582339..182582363 25/25 Antisense target smn1
Chr2:60450393..60450417 21/25 Sense off-target cttnbp2nl
Publications
First: Reduced levels of survival motor neuron protein leads to aberrant motoneuron growth in a Xenopus model of muscular atrophy., Neurogenetics 2010    
Most recent:
View All Papers