Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250346

Morpholino Name: smo MO1
Synonyms: X-Smo
mRNA Target: smo

Morpholino Type: uncategorized morpholino
Sequence:
5' CATGGAAGACATCTTGAGAAGTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' TCACTTCTCAAGATGTCTTCCATG 3' |||||||||||||||||||||||| 3' AGTGAAGAGTTCTACAGAAGGTAC 5' 5' TCACTTCTCAAGATGTCTTCCATG 3' |||||||||||||||||||||||| 3' AGTGAAGAGTTCTACAGAAGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12518:7943566..7943589 24/24 Antisense target smo.L
Scaffold104110:863190..863213 23/24 Antisense off-target Xelaev16001110m
tropicalis 7.1 scaffold_3:115678849..115678872 24/24 Antisense target smo
scaffold_6:140097853..140097876 20/24 Sense off-target gars
Publications
First: Hedgehog signaling and the retina: insights into the mechanisms controlling the proliferative properties of neural precursors., Genes Dev 2006  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556