Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250352

Morpholino Name: smyd1 MO1
Synonyms: Smyd1 MO
mRNA Target: smyd1

Morpholino Type: uncategorized morpholino
Sequence:
5' CATGGCTGTTCCGCTTCTACCCTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ACGGGGTAGAAGCGGAACAGCCATG 3' || |||||||||||||||||||||| 3' TGTCCCATCTTCGCCTTGTCGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:9292282..9292306 24/25 Antisense target smyd1.L
chr9_10L:27445058..27445082 21/25 Sense off-target dgke.L
Publications
First: smyd1 and smyd2 are expressed in muscle tissue in Xenopus laevis., Cytotechnology 2008  
Most recent:
View All Papers