Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250353

Morpholino Name: smyd2 MO1
Synonyms: Smyd2 MO
mRNA Target: smyd2

Morpholino Type: uncategorized morpholino
Sequence:
5' GTTCCAGACCCTCGGGCTGTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGGGACAGCCCGAGGGTCTGGAGC 3' ||||||||||||||||||||||| | 3' TACCCTGTCGGGCTCCCAGACCTTG 5' 5' ATGGGACAGCCCGAGGGTCTGGAAC 3' ||||||||||||||||||||||||| 3' TACCCTGTCGGGCTCCCAGACCTTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold102974:10343973..10343997 25/25 Antisense target smyd2.L
Scaffold27161:2460600..2460624 25/25 Antisense off-target Xelaev16037052m
tropicalis 7.1 scaffold_5:113007736..113007760 24/25 Antisense target smyd2
Publications
First: smyd1 and smyd2 are expressed in muscle tissue in Xenopus laevis., Cytotechnology 2008  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556