Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250355

Morpholino Name: snai1 MO2
Synonyms: Snail
mRNA Target: snai1

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGAGGATGCTGCTTACCTGTGTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACACACAGGTAAGCAGCATCCTCTA 3' ||||||||||||||||||||||||| 3' TGTGTGTCCATTCGTCGTAGGAGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14557:4836723..4836747 23/25 Antisense off-target Xelaev16013299m
Scaffold2511:569848..569872 23/25 unknown
Scaffold182899:18789..18813 21/25 Antisense off-target Xelaev16022636m
tropicalis 7.1 scaffold_10:12978967..12978991 25/25 Antisense target snai1
Publications
First: Microarray-based identification of VegT targets in Xenopus., Mech Dev 2005                                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556