Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250355

Morpholino Name: snai1 MO2
Synonyms: Snail
Target mRNA: snai1

Morpholino Type: uncategorized morpholino
Sequence: 5' TAGAGGATGCTGCTTACCTGTGTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' ACACACAGGTAAGCAGCATCCTCTA 3' ||||||||||||||||||||||||| 3' TGTGTGTCCATTCGTCGTAGGAGAT 5' 5' ACACACAGGTAAGCAGCACCCTCTG 3' |||||||||||||||||| ||||| 3' TGTGTGTCCATTCGTCGTAGGAGAT 5' 5' CCACACAGGTAAGCAGCACCCTCTA 3' ||||||||||||||||| |||||| 3' TGTGTGTCCATTCGTCGTAGGAGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:10474508..10474532 23/25 Antisense target snai1.L
chr9_10S:9417169..9417193 23/25 Antisense target snai1.S
chr8L:401272..401296 21/25 Antisense off-target gripap1.L
tropicalis 10.0 Chr10:36200582..36200606 25/25 Antisense target snai1
Chr1:217465786..217465810 21/25 unknown
Publications
First: Microarray-based identification of VegT targets in Xenopus., Mech Dev 2005                                            
Most recent:
View All Papers