Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250356

Morpholino Name: snai2 MO1
Synonyms: Slug MO, Slug MO-1, Snail2 (Slug) morpholino, Snail2 MO, XSlug MO, slug, snail2
mRNA Target: snai2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGTGGCATTTTCACTGCGGGCGGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 23/25 21/25
genomic

MO
5' TCTCTCCCGCACTGAAAATGCCACG 3' || | |||||| ||||||||||||| 3' AGGGCGGGCGTCACTTTTACGGTGC 5' 5' TCCCTCCCGCACTGAAAATGCCACG 3' |||| |||||| ||||||||||||| 3' AGGGCGGGCGTCACTTTTACGGTGC 5' 5' CCCCTCCCTCACTGAAAATGCCACG 3' ||| ||| || ||||||||||||| 3' AGGGCGGGCGTCACTTTTACGGTGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold79166:873269..873293 23/25 Antisense target snai2.L
Scaffold230826:1202321..1202345 21/25 Antisense target snai2.S
tropicalis 7.1 scaffold_6:36216408..36216432 22/25 Antisense target snai2
Publications
First: An NF-kappaB and slug regulatory loop active in early vertebrate mesoderm., PLoS One 2006                          
Most recent: Hmga2 is required for neural crest cell specification in Xenopus laevis., Dev Biol 2016                                          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556