Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250356

Morpholino Name: snai2 MO1
Synonyms: Slug MO, Slug MO-1, Snail2 (Slug) morpholino, Snail2 MO, XSlug MO, slug, snail2
Target mRNA: snai2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGTGGCATTTTCACTGCGGGCGGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 23/25 21/25
genomic

MO
5' TCTCTCCCGCACTGAAAATGCCACG 3' || | |||||| ||||||||||||| 3' AGGGCGGGCGTCACTTTTACGGTGC 5' 5' TCCCTCCCGCACTGAAAATGCCACG 3' |||| |||||| ||||||||||||| 3' AGGGCGGGCGTCACTTTTACGGTGC 5' 5' CCCCTCCCTCACTGAAAATGCCACG 3' ||| ||| || ||||||||||||| 3' AGGGCGGGCGTCACTTTTACGGTGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:114034032..114034056 23/25 Antisense target snai2.L
chr6S:90491747..90491771 21/25 Antisense target snai2.S
tropicalis 10.0 Chr6:113566711..113566735 22/25 Antisense target snai2
Publications
First: An NF-kappaB and slug regulatory loop active in early vertebrate mesoderm., PLoS One 2006                          
Most recent: Hmga2 is required for neural crest cell specification in Xenopus laevis., Dev Biol 2016                                          
View All Papers