Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250357

Morpholino Name: snai2 MO2
Synonyms: snail2, snail2 MO
mRNA Target: snai2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCTTGACCAGAAAAGATCGTGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' ATGCCACGATCTTTTCTGGTCAAGA 3' ||||||||||||||||||||||||| 3' TACGGTGCTAGAAAAGACCAGTTCT 5' 5' ATGCCACGATCTTTTCTGGTCAAGA 3' ||||||||||||||||||||||||| 3' TACGGTGCTAGAAAAGACCAGTTCT 5' 5' ATGCCACGCTCTTTTCTGGTCAAGA 3' |||||||| |||||||||||||||| 3' TACGGTGCTAGAAAAGACCAGTTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold79166:873252..873276 25/25 Antisense target snai2.L
Scaffold230826:1202304..1202328 24/25 Antisense target snai2.S
Scaffold2511:571845..571869 22/25 unknown
Scaffold141145:68038..68062 21/25 unknown
Scaffold172068:2495767..2495791 21/25 unknown
Scaffold18892:5548488..5548512 21/25 unknown
Scaffold220448:796040..796064 21/25 unknown
Scaffold267922:52161..52185 21/25 unknown
Scaffold26933:853295..853319 21/25 unknown
Scaffold307822:325277..325301 21/25 Antisense off-target Xelaev16041508m
Scaffold54274:406083..406107 21/25 Sense off-target Xelaev16061732m
Scaffold6290:2314900..2314924 21/25 unknown
Scaffold6590:11811913..11811937 21/25 unknown
Scaffold678:728784..728808 21/25 unknown
Scaffold9266:12057736..12057760 21/25 unknown
tropicalis 7.1 scaffold_6:36216425..36216449 25/25 Antisense target snai2
Publications
First: Snail2 controls mesodermal BMP/Wnt induction of neural crest., Development 2011                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556