Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250357

Morpholino Name: snai2 MO2
Synonyms: snail2, snail2 MO
Target mRNA: snai2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTTGACCAGAAAAGATCGTGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' ATGCCACGATCTTTTCTGGTCAAGA 3' ||||||||||||||||||||||||| 3' TACGGTGCTAGAAAAGACCAGTTCT 5' 5' ATGCCACGATCTTTTCTGGTCAAGA 3' ||||||||||||||||||||||||| 3' TACGGTGCTAGAAAAGACCAGTTCT 5' 5' ATGCCACGCTCTTTTCTGGTCAAGA 3' |||||||| |||||||||||||||| 3' TACGGTGCTAGAAAAGACCAGTTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:114034015..114034039 25/25 Antisense target snai2.L
chr6S:90491730..90491754 24/25 Antisense target snai2.S
chr9_10L:10476505..10476529 22/25 Antisense off-target snai1.L
chr1S:83345999..83346023 21/25 Sense off-target LOC734210 [provisional:nfic]
chr5L:150652008..150652032 21/25 Antisense off-target pkhd1.L
chr5L:58775536..58775560 21/25 Antisense off-target ero1b.L
chr2L:161110768..161110792 21/25 unknown
chr2L:20289135..20289159 21/25 unknown
chr3L:103394087..103394111 21/25 unknown
chr3L:32485778..32485802 21/25 unknown
chr5L:116292555..116292579 21/25 unknown
chr6L:140837837..140837861 21/25 unknown
chr6L:89820681..89820705 21/25 unknown
chr9_10L:115286966..115286990 21/25 unknown
chr8L:68089982..68090006 21/25 unknown
tropicalis 10.0 Chr6:113566694..113566718 25/25 Antisense target snai2
Publications
First: Snail2 controls mesodermal BMP/Wnt induction of neural crest., Development 2011                    
Most recent:
View All Papers