Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250358

Morpholino Name: snai2 MO3
Synonyms: XSlug
mRNA Target: snai2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCTTGACCAGAAAAGAGCGTGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' ATGCCACGATCTTTTCTGGTCAAGA 3' |||||||| |||||||||||||||| 3' TACGGTGCGAGAAAAGACCAGTTCT 5' 5' ATGCCACGATCTTTTCTGGTCAAGA 3' |||||||| |||||||||||||||| 3' TACGGTGCGAGAAAAGACCAGTTCT 5' 5' ATGCCACGCTCTTTTCTGGTCAAGA 3' ||||||||||||||||||||||||| 3' TACGGTGCGAGAAAAGACCAGTTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold230826:1202304..1202328 25/25 Antisense target snai2.S
Scaffold79166:873252..873276 24/25 Antisense target snai2.L
Scaffold2511:571845..571869 22/25 unknown
tropicalis 7.1 scaffold_6:36216425..36216449 24/25 Antisense target snai2
Publications
First: A Myc-Slug (Snail2)/Twist regulatory circuit directs vascular development., Development 2008                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556