Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250358

Morpholino Name: snai2 MO3
Synonyms: XSlug
Target mRNA: snai2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTTGACCAGAAAAGAGCGTGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' ATGCCACGATCTTTTCTGGTCAAGA 3' |||||||| |||||||||||||||| 3' TACGGTGCGAGAAAAGACCAGTTCT 5' 5' ATGCCACGATCTTTTCTGGTCAAGA 3' |||||||| |||||||||||||||| 3' TACGGTGCGAGAAAAGACCAGTTCT 5' 5' ATGCCACGCTCTTTTCTGGTCAAGA 3' ||||||||||||||||||||||||| 3' TACGGTGCGAGAAAAGACCAGTTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:90491730..90491754 25/25 Antisense target snai2.S
chr6L:114034015..114034039 24/25 Antisense target snai2.L
chr9_10L:10476505..10476529 22/25 Antisense off-target snai1.L
tropicalis 10.0 Chr6:113566694..113566718 24/25 Antisense target snai2
Publications
First: A Myc-Slug (Snail2)/Twist regulatory circuit directs vascular development., Development 2008                
Most recent:
View All Papers