Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250359

Morpholino Name: snw1 MO1
Synonyms: skip MO1, skip-MO1
mRNA Target: snw1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCATTTTCTCTGTCGATCTCTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAAGAGATCGACAGAGAAAATGGC 3' ||||||||||||||||||||||||| 3' CCTTCTCTAGCTGTCTCTTTTACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold289484:325277..325301 25/25 Antisense target snw1.S
Scaffold57559:2442301..2442325 22/25 unknown
Scaffold132381:822038..822062 21/25 unknown
tropicalis 7.1 scaffold_2:40052822..40052846 21/25 unknown
scaffold_4:45550518..45550542 21/25 unknown
scaffold_9:26535503..26535527 21/25 Antisense off-target pard3b
Publications
First: Xenopus skip modulates Wnt/beta-catenin signaling and functions in neural crest induction., J Biol Chem 2010                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556