Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250362

Morpholino Name: snw1 MO4
Synonyms: MoSNW1b
mRNA Target: snw1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCTATGGAGGAAGTGACCTAAGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTCTTAGGTCACTTCCTCCATAGCC 3' ||||||||||||||||||||||||| 3' GAGAATCCAGTGAAGGAGGTATCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold289484:325316..325340 25/25 Antisense target snw1.S
Scaffold39723:5942579..5942603 22/25 Antisense off-target Xelaev16050683m
Scaffold30404:3180087..3180111 21/25 unknown
Publications
First: SNW1 is a critical regulator of spatial BMP activity, neural plate border formation, and neural crest specification in vertebrate embryos., PLoS Biol 2011                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556