Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250366

Morpholino Name: sox11 MO1
Synonyms: sox11 MO
Target mRNA: sox11

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGCTCGCTGCACCATGGCTGTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TGACAGCCATGGTGCAGCGAGCAGA 3' ||||||||||||||||||||||||| 3' ACTGTCGGTACCACGTCGCTCGTCT 5' 5' TGACAGCCATGGTGCAGCGAGCAGA 3' ||||||||||||||||||||||||| 3' ACTGTCGGTACCACGTCGCTCGTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:135738476..135738500 25/25 Antisense target sox11.L
chr5S:116852243..116852267 25/25 Antisense target sox11.S
chr9_10L:44155712..44155736 21/25 Sense off-target LOC108701217 [provisional:rhbdl3]
tropicalis 10.0 Chr8:96639903..96639927 21/25 Sense off-target wdr25
Chr8:114581537..114581561 21/25 Antisense off-target disp2
Publications
First: WT1 and Sox11 regulate synergistically the promoter of the Wnt4 gene that encodes a critical signal for nephrogenesis., Exp Cell Res 2012  
Most recent: Deletions and de novo mutations of SOX11 are associated with a neurodevelopmental disorder with features of Coffin-Siris syndrome., J Med Genet 2016              
View All Papers