Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250374

Morpholino Name: sox2 MO1
Synonyms: Sox2MO
mRNA Target: sox2

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCGGTCTCCATCATGCTGTACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24
genomic

MO
5' TGTACAACATGATGGAGACCGATC 3' |||||| ||||||||||||||| | 3' ACATGTCGTACTACCTCTGGCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold168805:880832..880855 24/24 unknown
Scaffold30987:1304866..1304889 24/24 unknown
Scaffold1187:9976729..9976752 21/24 Sense off-target Xelaev16004956m
Scaffold150991:2184343..2184366 21/24 unknown
Scaffold3490:332319..332342 20/24 unknown
tropicalis 7.1 scaffold_5:12358015..12358038 22/24 Antisense target sox2
scaffold_5:53843963..53843986 20/24 unknown
Publications
First: Geminin cooperates with Polycomb to restrain multi-lineage commitment in the early embryo., Development 2011                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556