Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250375

Morpholino Name: sox2 MO2
Synonyms: Sox2 MO
mRNA Target: sox2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGCTCGGTCTCCATCATGCTGTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' GTACAACATGATGGAGACCGATCT 3' ||||| ||||||||||||||| || 3' CATGTCGTACTACCTCTGGCTCGA 5' 5' GTACAGCATGATGGAGACCGAGCT 3' |||||||||||||||||||||||| 3' CATGTCGTACTACCTCTGGCTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:104269257..104269280 24/24 Antisense target sox2.L
chr5L:104269257..104269280 24/24 Antisense off-target LOC108716997
chr5S:88904488..88904511 24/24 Antisense off-target LOC108718087
chr3S:112728092..112728115 21/24 unknown
chr1L:185208648..185208671 20/24 Sense off-target zfyve16.L
chr4L:124657925..124657948 20/24 Antisense off-target grm7.L
chr5L:18339186..18339209 20/24 Sense off-target galnt14.L
chr9_10S:61627202..61627225 20/24 Antisense off-target nfe2l2.S
tropicalis 10.0 Chr5:108037421..108037444 22/24 Antisense target sox2
Chr9:65696914..65696937 20/24 Antisense off-target nfe2l2
Publications
First: Frizzled 5 signaling governs the neural potential of progenitors in the developing Xenopus retina., Neuron 2005                          
Most recent: Spinal cord regeneration in Xenopus laevis., Nat Protoc 2017        
View All Papers