Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250375

Morpholino Name: sox2 MO2
Synonyms: Sox2 MO
mRNA Target: sox2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGCTCGGTCTCCATCATGCTGTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24
genomic

MO
5' GTACAACATGATGGAGACCGATCT 3' ||||| ||||||||||||||| || 3' CATGTCGTACTACCTCTGGCTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold168805:880833..880856 24/24 unknown
Scaffold30987:1304867..1304890 24/24 unknown
Scaffold48253:1630041..1630064 21/24 unknown
Scaffold102974:3918510..3918533 20/24 Sense off-target Xelaev16000598m
Scaffold1187:9976730..9976753 20/24 Sense off-target Xelaev16004956m
Scaffold150991:2184344..2184367 20/24 unknown
Scaffold4321:5587313..5587336 20/24 Antisense off-target nfe2l2.S
tropicalis 7.1 scaffold_5:12358014..12358037 22/24 Antisense target sox2
scaffold_9:20203770..20203793 20/24 Antisense off-target nfe2l2
Publications
First: Frizzled 5 signaling governs the neural potential of progenitors in the developing Xenopus retina., Neuron 2005                          
Most recent: Spinal cord regeneration in Xenopus laevis., Nat Protoc 2017        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556