Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250376

Morpholino Name: sox2 MO3
Synonyms: 19F1.1moA
mRNA Target: sox2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCCATCATGTTGTACATTCAGGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGCCTGAATGTACAACATGATGGAG 3' ||||||||||||||||||||||||| 3' GCGGACTTACATGTTGTACTACCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold26364:2680736..2680760 21/25 unknown
Scaffold47533:318929..318953 21/25 unknown
tropicalis 7.1 scaffold_5:12358022..12358046 25/25 Antisense target sox2
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556