Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250377

Morpholino Name: sox2 MO4
Synonyms: Sox2
mRNA Target: sox2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCCATCATGCTGTACATGCAGGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold168805:880824..880848 24/25 unknown
Scaffold30987:1304858..1304882 23/25 unknown
Scaffold150991:2184335..2184359 21/25 unknown
Scaffold298574:256481..256505 21/25 Sense off-target Xelaev16039992m
Scaffold33104:3138914..3138938 21/25 unknown
Scaffold91373:181254..181278 21/25 unknown
tropicalis 7.1 scaffold_722:30383..30407 21/25 Antisense off-target slc35b2
Publications
First: Eya1 and Six1 promote neurogenesis in the cranial placodes in a SoxB1-dependent fashion., Dev Biol 2008                    
Most recent: A transition from SoxB1 to SoxE transcription factors is essential for progression from pluripotent blastula cells to neural crest cells., Dev Biol 2018                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.0


Major funding for Xenbase is provided by grant P41 HD064556