Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250378

Morpholino Name: sox3 MO1
Synonyms: 30F5.2moA
mRNA Target: sox3

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTCTGTGTCCAACATGCTATACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGTATAGCATGTTGGACACAGACC 3' ||||||||||||||||||||||||| 3' TACATATCGTACAACCTGTGTCTGG 5' 5' ATGTATAGCATGTTGGACACCGACA 3' |||||||||||||||||||| ||| 3' TACATATCGTACAACCTGTGTCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold151989:147370..147394 24/25 Antisense off-target Xelaev16015158m
Scaffold15436:487970..487994 23/25 Antisense target sox3.S
Scaffold68908:2588311..2588335 22/25 Sense off-target tsku.L
tropicalis 7.1 scaffold_8:35310192..35310216 25/25 Antisense target sox3
scaffold_4:57727853..57727877 21/25 Antisense off-target atg2a
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556