Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250379

Morpholino Name: sox3 MO2
Synonyms: Sox3MO
mRNA Target: sox3

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTCGGTGTCCAACATGCTATACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGTATAGCATGTTGGACACAGACC 3' |||||||||||||||||||| ||| 3' TACATATCGTACAACCTGTGGCTGT 5' 5' ATGTATAGCATGTTGGACACCGACA 3' ||||||||||||||||||||||||| 3' TACATATCGTACAACCTGTGGCTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15436:487970..487994 25/25 Antisense target sox3.S
Scaffold151989:147370..147394 24/25 Antisense off-target Xelaev16015158m
Scaffold46215:2441543..2441567 21/25 Sense off-target prss57.L
tropicalis 7.1 scaffold_8:35310192..35310216 23/25 Antisense target sox3
scaffold_4:95995975..95995999 21/25 unknown
Publications
First: Xenopus Sox3 activates sox2 and geminin and indirectly represses Xvent2 expression to induce neural progenitor formation at the expense of non-neural ectodermal derivatives., Mech Dev 2009          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556