Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250379

Morpholino Name: sox3 MO2
Synonyms: Sox3MO
Target mRNA: sox3

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTCGGTGTCCAACATGCTATACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genomic

MO
5' ATGTATAGCATGTTGGACACAGACC 3' |||||||||||||||||||| ||| 3' TACATATCGTACAACCTGTGGCTGT 5' 5' ATGTATAGCATGTTGGACACAGACA 3' |||||||||||||||||||| |||| 3' TACATATCGTACAACCTGTGGCTGT 5' 5' ATGTATAGCATGTTGGACACCGACA 3' ||||||||||||||||||||||||| 3' TACATATCGTACAACCTGTGGCTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:61007073..61007097 25/25 Antisense target sox3.S
chr8L:33820528..33820552 24/25 Antisense target sox3.L
chr1L:103269780..103269804 21/25 Sense off-target prss57.L
tropicalis 10.0 Chr8:55347976..55348000 23/25 Antisense target sox3
Chr4:86066869..86066893 21/25 Sense off-target nfia
Publications
First: Xenopus Sox3 activates sox2 and geminin and indirectly represses Xvent2 expression to induce neural progenitor formation at the expense of non-neural ectodermal derivatives., Mech Dev 2009          
Most recent:
View All Papers