Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250380

Morpholino Name: sox3 MO3
Synonyms: Sox3, xsox3
mRNA Target: sox3

Morpholino Type: uncategorized morpholino
Sequence:
5' AACATGCTATACATTTGGAGCTTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 24/25
genomic

MO
5' TGCAGCTCCAGATGTATAGCATGTT 3' || ||||||| |||||||||||||| 3' ACTTCGAGGTTTACATATCGTACAA 5' 5' TGCAGCTCCAAATGTATAGCATGTT 3' || |||||||||||||||||||||| 3' ACTTCGAGGTTTACATATCGTACAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15436:487981..488005 24/25 Antisense target sox3.S
Scaffold151989:147381..147405 22/25 Antisense off-target Xelaev16015158m
tropicalis 7.1 scaffold_21:314199..314223 23/25 unknown
scaffold_8:35310181..35310205 23/25 Antisense target sox3
Publications
First: The beta-catenin/VegT-regulated early zygotic gene Xnr5 is a direct target of SOX3 regulation., Development 2003    
Most recent: A transition from SoxB1 to SoxE transcription factors is essential for progression from pluripotent blastula cells to neural crest cells., Dev Biol 2018                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556