Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250380

Morpholino Name: sox3 MO3
Synonyms: Sox3, xsox3
Target mRNA: sox3

Morpholino Type: uncategorized morpholino
Sequence: 5' AACATGCTATACATTTGGAGCTTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25 24/25
genomic

MO
5' TGCAGCTCCAGATGTATAGCATGTT 3' || ||||||| |||||||||||||| 3' ACTTCGAGGTTTACATATCGTACAA 5' 5' CGCAGCTCCAGATGTATAGCATGTT 3' | ||||||| |||||||||||||| 3' ACTTCGAGGTTTACATATCGTACAA 5' 5' TGCAGCTCCAAATGTATAGCATGTT 3' || |||||||||||||||||||||| 3' ACTTCGAGGTTTACATATCGTACAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:61007084..61007108 24/25 Antisense target sox3.S
chr8L:33820539..33820563 22/25 Antisense target sox3.L
tropicalis 10.0 Chr8:55347987..55348011 23/25 Antisense target sox3
Chr9:79707061..79707085 23/25 unknown
Publications
First: The beta-catenin/VegT-regulated early zygotic gene Xnr5 is a direct target of SOX3 regulation., Development 2003    
Most recent: A transition from SoxB1 to SoxE transcription factors is essential for progression from pluripotent blastula cells to neural crest cells., Dev Biol 2018                  
View All Papers