Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250382

Morpholino Name: sox5 MO1
Synonyms: xSox5 MO
mRNA Target: sox5

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CTCGGGCTCAGTGAGCATTTCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' CAGAAATGCTCACTGAGCCCGAG 3' ||||||||||||||||||||||| 3' GTCTTTACGAGTGACTCGGGCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold70246:208554..208576 23/23 Antisense target sox5.S
Scaffold132123:191059..191081 22/23 Antisense off-target Xelaev16009042m
Scaffold102068:93892..93914 19/23 Antisense off-target Xelaev16000324m
Scaffold6754:2172272..2172294 19/23 unknown
tropicalis 7.1 scaffold_4:2824577..2824599 20/23 unknown
Publications
First: The protein kinase MLTK regulates chondrogenesis by inducing the transcription factor Sox6., Development 2012                          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556