Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250384

Morpholino Name: sox7 MO1
Synonyms: 7MO, sox17 7MO, sox7, xsox7
Target mRNA: sox7

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCCATCAGGGTAGTCATTATTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 22/25
genomic

MO
5' GGAGTTATGACTACCCTGATGGGAT 3' ||| | ||||||||||||||||||| 3' CCTTATTACTGATGGGACTACCCTA 5' 5' GGAATAATGACTACCCTGATGGGAT 3' ||||||||||||||||||||||||| 3' CCTTATTACTGATGGGACTACCCTA 5' 5' GGAGTTATGACCACCCTGATGGGAT 3' ||| | ||||| ||||||||||||| 3' CCTTATTACTGATGGGACTACCCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:151838810..151838834 25/25 Antisense target sox7.L
chr5S:130897317..130897341 22/25 Antisense target sox7.S
chr6S:77238715..77238739 21/25 Sense off-target znf516.S
tropicalis 10.0 Chr5:151185215..151185239 23/25 Antisense target sox7
Publications
First: The beta-catenin/VegT-regulated early zygotic gene Xnr5 is a direct target of SOX3 regulation., Development 2003    
Most recent: Genome-wide transcriptomics analysis of genes regulated by GATA4, 5 and 6 during cardiomyogenesis in Xenopus laevis., Data Brief 2018    
View All Papers