Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250385

Morpholino Name: sox8 MO1
Synonyms: Sox8mo
mRNA Target: sox8

Morpholino Type: uncategorized morpholino
Sequence:
5' TCATGTTCAGCATTGAGGAGCCGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CCCGGCTCCTCAATGCTGAACATGA 3' ||||||||||||||||||||||||| 3' GGGCCGAGGAGTTACGACTTGTACT 5' 5' CCCGGCTCCTCAATGCTGAACATGA 3' ||||||||||||||||||||||||| 3' GGGCCGAGGAGTTACGACTTGTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold219295:566149..566173 25/25 Antisense target sox8.L
Scaffold10188:548896..548920 24/25 Antisense off-target Xelaev16000311m
Scaffold36364:3241654..3241678 21/25 unknown
tropicalis 7.1 scaffold_9:82455904..82455928 25/25 Antisense target sox8
scaffold_5:82060039..82060063 21/25 Antisense off-target mthfd1l
Publications
First: Functional analysis of Sox8 during neural crest development in Xenopus., Development 2006                
Most recent: Reiterative AP2a activity controls sequential steps in the neural crest gene regulatory network., Proc Natl Acad Sci U S A 2011          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556