Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250386

Morpholino Name: sox9 MO1
Synonyms: Sox9 MO, Sox9-AS, Sox9-mo, xSox9 MO
mRNA Target: sox9

Morpholino Type: uncategorized morpholino
Sequence:
5' GCAAAAATGGGGAAAGGTAAGAAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTTTCTTACCTTTCCCCATTTTTGC 3' ||||||||||||||||||||||||| 3' GAAAGAATGGAAAGGGGTAAAAACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold159815:1540817..1540841 25/25 Antisense target sox9.S
Scaffold12020:14562952..14562976 22/25 Sense off-target Xelaev16005460m
Scaffold60618:959524..959548 22/25 unknown
Scaffold102277:786129..786153 21/25 unknown
Scaffold13787:4643328..4643352 21/25 unknown
Scaffold14557:179361..179385 21/25 unknown
Scaffold146311:2274948..2274972 21/25 Sense off-target Xelaev16013585m
Scaffold155263:3816..3840 21/25 Antisense off-target cyp2f1.S
Scaffold164049:2288898..2288922 21/25 unknown
Scaffold169004:1280917..1280941 21/25 unknown
Scaffold230550:274039..274063 21/25 unknown
Scaffold43242:12130619..12130643 21/25 unknown
Scaffold78860:3708416..3708440 21/25 unknown
tropicalis 7.1 scaffold_7:24246577..24246601 22/25 unknown
scaffold_5:89501749..89501773 21/25 unknown
Publications
First: The transcription factor Sox9 is required for cranial neural crest development in Xenopus., Development 2002          
Most recent: PFKFB4 control of AKT signaling is essential for premigratory and migratory neural crest formation., Development 2017                                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556