Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250386

Morpholino Name: sox9 MO1
Synonyms: Sox9 MO, Sox9-AS, Sox9-mo, xSox9 MO
Target mRNA: sox9

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAAAAATGGGGAAAGGTAAGAAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTTTCTTACCTTTCCCCATTTTTGC 3' ||||||||||||||||||||||||| 3' GAAAGAATGGAAAGGGGTAAAAACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:19079571..19079595 25/25 Antisense target sox9.S
chr1S:113143970..113143994 22/25 Sense off-target sema4d.S
chr1S:148406375..148406399 21/25 Sense off-target chd1.S
chr1S:16562491..16562515 21/25 Sense off-target stk32b.S
chr2L:122210699..122210723 21/25 Antisense off-target LOC108708487 [provisional:gpc6]
chr2S:94456002..94456026 21/25 Antisense off-target LOC108708959 [provisional:aff3]
chr5S:128878218..128878242 21/25 Antisense off-target cyp2f1.S
chr9_10S:14074531..14074555 21/25 Sense off-target LOC108702627 [provisional:cdh4]
chr4S:76374371..76374395 22/25 unknown
chr4L:43175817..43175841 21/25 unknown
chr5L:62887524..62887548 21/25 unknown
chr9_10L:59750419..59750443 21/25 unknown
chr9_10L:72525931..72525955 21/25 unknown
tropicalis 10.0 Chr3:104343362..104343386 21/25 Sense off-target fam227b
Chr5:37495018..37495042 21/25 Antisense off-target dtd1
Chr7:29683746..29683770 22/25 unknown
Publications
First: The transcription factor Sox9 is required for cranial neural crest development in Xenopus., Development 2002          
Most recent: PFKFB4 control of AKT signaling is essential for premigratory and migratory neural crest formation., Development 2017                                  
View All Papers