Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250398

Morpholino Name: spred1 MO1
Synonyms: Sprd1 ATG
mRNA Target: spred1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTGTTCGCCGCTCATTGTCCCCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 21/25
genomic

MO
5' AAGGGGACAATGAGCGGCGAACAGG 3' ||||||||||||||||||||||||| 3' TTCCCCTGTTACTCGCCGCTTGTCC 5' 5' AAGGGGACAATGAGCGGCGAACAGG 3' ||||||||||||||||||||||||| 3' TTCCCCTGTTACTCGCCGCTTGTCC 5' 5' GGGGGGACAATGAGCGGCGAACTAG 3' |||||||||||||||||||| | 3' TTCCCCTGTTACTCGCCGCTTGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:88480323..88480347 25/25 Antisense target spred1.L
chr8S:2030230..2030254 21/25 Antisense target spred1.S
tropicalis 10.0 Chr8:110841458..110841482 25/25 Antisense target spred1
Publications
First: FGF signal interpretation is directed by Sprouty and Spred proteins during mesoderm formation., Dev Cell 2005        
Most recent:
View All Papers