Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250399

Morpholino Name: spred1 MO2
Synonyms: Sprd1 e1i1
mRNA Target: spred1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTGGCACTCACTCTGGCTCCTGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' AACAGGAGCCAGAGTGAGTGCCACC 3' ||||||||||||||||||||||||| 3' TTGTCCTCGGTCTCACTCACGGTGG 5' 5' AACAGGAGCCAGAGTAAGTGCCACC 3' ||||||||||||||| ||||||||| 3' TTGTCCTCGGTCTCACTCACGGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:88480304..88480328 24/25 Antisense target spred1.L
chr2L:90258891..90258915 21/25 Antisense off-target tbx2.L
chr2S:75682085..75682109 21/25 unknown
chr6L:2594976..2595000 21/25 unknown
tropicalis 10.0 Chr8:110841439..110841463 25/25 Antisense target spred1
Chr4:99875023..99875047 21/25 Sense off-target abl2
Publications
First: FGF signal interpretation is directed by Sprouty and Spred proteins during mesoderm formation., Dev Cell 2005        
Most recent:
View All Papers